Advertisement
Endothelium-specific loss of murine thrombomodulin disrupts the protein C anticoagulant pathway and causes juvenile-onset thrombosis
Berend Isermann,1 Sara B. Hendrickson,1 Mark Zogg,1 Mark Wing,1 Marjorie Cummiskey,2 Yaz Y. Kisanuki,3 Masashi Yanagisawa,3 and Hartmut Weiler1,2
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Isermann, B. in: JCI | PubMed | Google Scholar
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Hendrickson, S. in: JCI | PubMed | Google Scholar
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Zogg, M. in: JCI | PubMed | Google Scholar
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Wing, M. in: JCI | PubMed | Google Scholar
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Cummiskey, M. in: JCI | PubMed | Google Scholar
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Kisanuki, Y. in: JCI | PubMed | Google Scholar
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Yanagisawa, M. in: JCI | PubMed | Google Scholar
1Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin, USA2Medical College of Wisconsin, Milwaukee, Wisconsin, USA3Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, USA
Address correspondence to: Hartmut Weiler, Blood Research Institute, The Blood Center of Southeastern Wisconsin, PO Box 2178, Milwaukee, Wisconsin 53226, USA. Phone: (414) 937-3813; Fax: (414) 937-6284; E-mail: hweiler@bcsew.edu.
Find articles by Weiler, H. in: JCI | PubMed | Google Scholar
Published August 15, 2001 - More info
J Clin Invest. 2001;108(4):537–546. https://doi.org/10.1172/JCI13077.
© 2001 The American Society for Clinical Investigation
Received: April 19, 2001; Accepted: July 4, 2001
-
Methods
Gene targeting and generation of transgenic animals. The structure of the gene-targeting vector is shown in Figure 1a. A polyadenylation signal derived from the mouse PGK-Ib gene followed by a neomycin gene-expressing cassette was inserted into a unique SpeI site within the 3′-untranslated region of the mouse TM gene. LoxP sequences were inserted into the 5′-untranslated region adjacent to the translation initiation codon of the TM gene and at the 3 -end of the neomycin gene–expressing cassette.
Figure 1(a) Targeted mutagenesis of the wild-type TM gene (TMwt) results in the insertion of a loxP site immediately 5′ of the translation initiation codon and 3′ of the neomycin gene-expression cassette (neo). TK, thymidine kinase expression cassette. (b) Correctly targeted ES cells were identified by Southern blot hybridization analysis with external probe A (see a). (c) Mouse DNA was analyzed by PCR using the sense primer P1 (5′- aggttgtgatagaggctagctgctgtc -3′) and the antisense primer P2 (5′- ggccctaaatccatactgctct -3′), resulting in a 376-bp fragment for the TM wild-type allele, and the antisense primer P3 (5′- atgtgctgcaaggcgattaagttgg -3′), resulting in a 199-bp fragment for the TMlacZ allele (primer P3 is derived from the TMlacZ gene and is not shown in Figure 1a). The antisense primer P4 (5′- ggcccagtatgtctcaagatagcaatg -3′) yielded a 408-bp fragment only after deletion of the endogenous TM gene by Cre-recombinase. Immunohistochemical detection of TM in the lung (d and g), the brain (e and h), and the placenta (f and i) in TMwt (d–f) and TMLox (g–i) mice. Brown-black horseradish peroxidase reaction product identifies TM antigen. In TMLox mice, TM is absent in almost all lung capillaries (g) and brain endothelial cells (h, arrows), whereas nonendothelial cells such as meninges (h, arrowheads), giant trophoblast and parietal endoderm cells (i, arrowheads identify parietal endoderm) stain for TM. Arrows in e and f indicate meninges (top) and blood vessels. Original magnification is indicated at lower right.
Targeting of the TM-gene in D3 embryonic stem (ES) cells and selection of drug resistant ES cell clones was performed as described previously (17). Correctly targeted ES cell clones were identified by Southern blot hybridization of genomic DNA digested with NcoI and KpnI. Hybridization with a DNA probe external to the TM gene sequences contained in the targeting vector (Figure 1a, probe A) resulted in 3.75-kb and 4.05-kb signals for the wild-type TM allele (TMwt) and the correctly targeted TM allele (TMLox-neo), respectively (Figure 1b). Mice heterozygous for the targeted mutation (TMwt/Lox-neo) were generated by blastocyst injection with targeted ES cells and breeding of the resulting germline chimeras to C57BL/6 females. TMwt/Lox-neo mice were then bred to transgenic mice expressing Cre-recombinase under the control of the tie2-promoter/enhancer (18), resulting in TMwt/LoxCretg mice. To maximize the ratio of Cre-recombinase product over its substrate (the conditional TM gene), we established a mouse strain that was heterozygous for the TM loss-of-function mutation (TMlacZ) (16, 17) and at the same time carried the Cre-transgene (TMwt/lacZCretg). TMwt/lacZCretg and TMwt/LoxCretg mice were then bred to yield experimental mice (TMLox, genotype TMLox/lacZCretg) and control mice (TMwt, sex-matched littermates, genotype TMwt/lacZCretg). Offspring were genotyped using genomic DNA isolated from a tail biopsy and employing multiplex PCR (Figure 1c). All animals were housed and experiments performed in the Animal Resource Center at the Medical College of Wisconsin, following standards and procedures approved by the local Animal Care and Use Committee.
In vivo PC activation. Animals were injected with 20 μg of human PC and 50 mU of α-thrombin (Enzyme Research Laboratories, South Bend, Indiana, USA) into the vena femoralis. Blood samples were collected after 10 minutes from the vena cava into 0.38% sodium citrate and 50 mM benzamidine HCl (final concentration). Human PC/activated PC (APC) was captured from plasma samples using an antibody specific for human PC/APC (HAPC 1555; kind gift of G. Ferrell, Oklahoma City, Oklahoma, USA), and the activity of the captured human PC was determined using a chromogenic substrate (PCa; American Diagnostica, Greenwich, Connecticut, USA) (19). Background (TM-independent) APC formation was determined by adding thrombin and PC at concentrations corresponding to the final concentration achieved in vivo to TM-depleted mouse plasma. PBMCs were prepared by density gradient centrifugation (Nyco-Prep 1.077 A; Nycomed Pharmas, Torshov, Norway), followed by adherence to tissue culture dishes as described elsewhere (20). Adherent cells were greater than 95% monocytes as assessed by Giemsa staining. Peritoneal macrophages were isolated 4 days after intraperitoneal injection of Brewer’s thioglycollate broth (4%) (21). TM-dependent APC formation by mononuclear cells was established using a two-step assay for PC activation (22).
Gonadectomy. For removal of testes, a small incision in the anterior abdominal wall was made, the ductus deferens and adjacent blood vessels were ligated, testes removed, and the wound closed with a metal clip. Ovaries were removed through an incision over the lower back. The uterine tube, the ligaments attached to the ovary, and adjacent blood vessels were ligated, the ovaries removed, and the skin closed with a metal clip. Only a skin incision was made in sham-operated animals.
Warfarin anticoagulation. Warfarin [3-(α-Acetonylbenzyl)-4-Hydroxy-Coumarin; Sigma Chemical Co., St. Louis, Missouri, USA] was added to the drinking water at a concentration of 2 μg/ml (freshly prepared three times a week). This dosage prolonged whole-blood clotting time from 6.8 to 24.9 minutes (P < 0.001) and reduced factor X activation by 73% (P < 0.001), but caused hemorrhagic complications only in a minority of mice. Anticoagulation of experimental (TMLox) and control (TMwt) mice was initiated in mice less than 3 weeks old and continued for a period of 8 weeks. A placebo group received normal water only.
Analyses of blood coagulation, plasma cytokines, cross-linked tissue fibrin, and hematological parameters. Whole-blood clotting time was determined by monitoring the formation of a blood clot while stirring with a metal loop every 30 seconds for the first 10 minutes, and thereafter every 2 minutes up to 60 minutes. Blood samples for other assays were obtained from the inferior vena cava of anticoagulated mice (8,000 U heparin intraperitoneally, unfractionated porcine heparin, sodium-salt; Life Technologies Inc., Grand Island, New York, USA). Thrombin-antithrombin complexes (TAT) and D-Dimer were determined using commercially available ELISA systems that recognized mouse TAT (23) and mouse D-Dimer (24), respectively (Enzygnost TAT micro; Behring Diagnostic Inc., Westwood, Massachusetts, USA, and Asserachrom D-Di; American Bioproducts Co., Parsippany, New Jersey, USA, respectively). Fibrinogen levels were measured by sandwich ELISA using a rabbit anti-human fibrinogen antibody (DAKO Corp., Carpinteria, California, USA) and a peroxidase-conjugated goat anti-mouse fibrinogen antibody (Accurate International, Westbury, New York, USA). The assay was calibrated with purified mouse fibrinogen (a kind gift of M.W. Mosesson, Blood Research Institute, Milwaukee, Wisconsin, USA). Plasma IL-1β and IL-6 were measured with mouse specific ELISA systems (R&D Systems Inc., Minneapolis, Minnesota, USA). TM-antigen and cross-linked fibrin in tissue extracts were measured as described previously (16, 22). Megakaryocytes numbers in the spleen were determined by disruption of the spleen (60-count wire mesh; Sigma Chemical Co.) in RPMI-5% FBS, centrifugation (400 g for 5 minutes), and incubation of resuspended cells in TRIS ammonium chloride (0.75% wt/vol, in TRIS [pH 7.2]) for 5 minutes at 37°C. Cells were washed twice in RPMI-5% FBS, transferred onto glass slides with a cytospin (150 g for 6 minutes), air dried, and stained for acetylcholinesterase (25). The number of megakaryocytes per slide was normalized to the total number of splenocytes per slide. Leukocyte and platelet numbers were counted manually.
Histology and immunohistochemistry. Tissues were fixed in 4% buffered paraformaldehyde, paraffin embedded, and processed for sectioning. Tissues containing bones were fixed and decalcified in CAL-EX (Fisher Scientific Co., Fair Lawn, New Jersey, USA). Immunohistochemical detection of TM with the TM-specific mAb 201 B and of fibrinogen with a polyclonal rabbit anti-human fibrinogen antibody (DAKO Corp.) was performed as described previously (16). Gomori’s one-step trichrome stain was used for the visualization of interstitial collagen.
Statistical analyses. Results are shown as mean ± SEM. Statview software (SAS Institute, Cary, North Carolina, USA) was used for all statistical analyses. The unpaired Student’s t test was used to compare values between TMLox mice and TMwt mice, except for the comparison of body weights, where the paired Student’s t test was used to compare sex-matched littermates. Kaplan-Meier curves and logrank test were employed to analyze the time course of disease manifestation and death.
-
Results
Generation of mice with endothelial-specific TM ablation. The DNA-targeting construct containing the loxP sites is shown in Figure 1a. Homologous recombination between the targeting construct and the endogenous TM gene resulted in the insertion of loxP sides flanking the TM gene and the neomycin expression cassette (Figure 1a, TMLox-neo). Two lines of mice with the correctly targeted TMLox-neo gene were established from two independently generated ES cell lines, and both mouse lines produced the same phenotype. Mice derived from only one line were used for the majority of subsequent experiments. Disruption of the TM gene in endothelial cells was achieved by crossing TMwt/LoxCretg and TMwt/lacZCretg mice, yielding TMLox/lacZCretg (“TMLox”) mice. This breeding strategy yielded also mice harboring the floxed TM gene (TMLox-neo) as well as the inactivated TMlacZ allele, but lacking the Cre-transgene (TMLox-neo/lacZ). TMLox-neo/lacZ mice developed normally and appeared healthy throughout adulthood, indicating that the TMLox-neo allele sustains sufficient and correctly regulated TM expression during development and adulthood. The preservation of tissue-specific expression of TM was confirmed by immunohistochemistry (data not shown).
The Cre-Lox–dependent excision of TM in experimental TMLox mice (TMLox/lacZCretg) was confirmed by PCR as described in Methods (Figure 1c). Analyses of TM expression in tissue extracts obtained from TMLox mice and TM-expressing control mice (TMwt mice) revealed dramatically reduced, but not completely absent, TM levels (data not shown). In vivo PC activation of TMwt, TMLox, and heterozygous TM (TMwt/lacZ) mice injected with human PC and α-thrombin was reduced to 61% (± 30%) and 34% (± 11%) in TMwt/lacZ and TMLox mice, respectively, compared with TMwt mice. PBMCs and thioglycollate-stimulated peritoneal macrophages from TMwt, TMLox, and TMwt/lacZ mice did not exhibit detectable PC activation. PBMCs lacked immunohistochemically detectable TM. The more sensitive β-galactosidase stain indicated TM expression in less than 0.1% of PBMCs derived from TMwt/lacZ mice. Immunohistochemistry using a TM-specific antibody was used to determine whether the observed residual TM expression and in vivo PC activation was secondary to incomplete ablation of the TM gene in endothelial cells. TM expression was detected in less than 1% of lung and brain capillaries, but was not detected in any other small and large blood vessels in 3- and 8-week-old TMLox mice (Figure 1, g and h). Conversely, TM expression was readily detected in nonendothelial, TM-expressing tissue such as the meninges (Figure 1h), in testicular interstitium, in pericardium, and in parietal endoderm and trophoblast cells of E 9.5 TMLox mouse embryos (Figure 1i) indicating tissue-specific inactivation of the TM-gene. Yolk sac vasculature of E 9.5 postcoitus (pc) embryos showed patchy TM-staining (∼50% of yolk sac vessels), indicating incomplete gene ablation in vascular endothelium at this stage.
Partial embryonic lethality of TMLox mice. Three weeks after birth, only approximately 60% of the expected number of TMLox mice was found (Table 1). Timed matings revealed a normal frequency of TMLox embryos at days 9.5 and 10.5 pc, but a reduced number of mutant embryos at days 14.5 and 16.5 pc (Table 1). All TMLox embryos retrieved at day 9.5 pc were phenotypically normal, whereas 36% (5 of 14) of TMLox embryos retrieved at day 10.5 pc displayed embryonic pallor or placental thrombosis. The remaining 64% of TMLox embryos at day 10.5 pc appeared normal, closely matching the frequency of TMLox mice at later developmental stages (days 14.5 and 16.5 pc) and at weaning age. Taken together, partial embryonic lethality affecting 40% of TMLox embryos occurs around day 10.5 pc, whereas the remaining TMLox embryos survive until genotyping age. Of note, hemorrhage within the embryo proper was not observed in TMLox embryos at any stage.
Table 1Frequency of TMLox mice found at various gestational stages (days pc) and at weaning age (3 weeks)
Spontaneous thrombosis in TMLox mice. Born TMLox mice appeared generally healthy during the first postnatal weeks, except for a reduced body weight. At weaning age, 14% of TMLox mice were markedly smaller (runt), and in the remaining 86% of TMLox mice, the body weight (Figure 2a) and weight gain were markedly reduced over an 8-week period.
Figure 2Disease progression and death in TMLox mice. Reduced body weight, phenotypical disease onset, and death in TMLox mice at young age. (a) Body weight in TMwt and TMLox littermates. The body weight of TMLox mice is reduced at weaning age and remains low thereafter. TMLox mice (excluding runt animals), filled circles; TMwt mice, open diamonds. Paired t test; n = 27; error bars = SEM. *P < 0.05, **P < 0.01. Manifestation of phenotypes (b) and death (c) approaches 100% within 20 and 30 weeks, respectively, and occurs earlier in male than in female mice. Males, filled squares; n = 23. Females, open triangles; n = 25.
Between ages 3 and 20 weeks, 198 of 199 TMLox mice developed a macroscopically visible phenotype, or died spontaneously (Figure 2b). Study end points determining a “phenotype onset” were the occurrence of death secondary to consumptive coagulopathy or progressive thrombosis, hemorrhage/ necrosis of individual digits, extremities, skin, ears, tongue, or priapism, but excluded tail necrosis, as the latter was frequently triggered by tail cutting. Early skin lesion consisted of small hemorrhagic lesion (Figure 3b), which subsequently increased in size and became necrotic (Figure 3, a and c). Necrosis of distal phalanges was frequently associated with severe edematous swelling (Figure 3d). Skin lesions occurred on the extremities (tail, 77.9% of TMLox mice; hind limbs, 57.4%), the perineal region (18.9%), the abdominal skin (15.8%), the ears (6.7%), and at other sites (7.2%). TMLox mice died either spontaneously (37.2%) or were sacrificed (57.1%) in the case of advanced disease. The overall survival of male mice was shorter than that of female mice (Figure 2c), and all mice surviving the observation period of 35 weeks were females (5.7%). A sex difference was also apparent in the disease onset, as male mice developed a phenotype at a younger age than female mice (Figure 2b).
Figure 3Thromboembolic disease in TMLox mice. TMLox mice develop hemorrhagic lesions and organ necrosis and succumb to consumptive coagulopathy. (a) Typical necrotic lesion of the skin, the ears, and the tail in TMLox mice. Early and small hemorrhagic skin lesions (b) subsequently progress into larger necrotic lesions (c and d; left foot in d: TMwt littermate). (e) Macroscopic specimen of a mouse with priapism: hemorrhagic necrosis of the penis (arrow) and testis (arrowhead). (f and g) Multiple necrosis of the liver (f, arrows) and swollen, hemorrhagic liver lobe (g, arrows) in TMLox mice (arrowhead in g: unaffected liver tissue). (h) Gastrointestinal bleeding at the disease end-stage in a TMLox mouse. (i) Multiple hemorrhagic lesions in the lung of a TMLox mouse.
Upon autopsy and histological examination, liver lesions were prevalent in 35.9% of TMLox mice and presented either as liver infarcts (26.9%, Figure 3f) or as hemorrhagic swelling of entire liver lobes, reminiscent of the Budd Chiari syndrome (9.0 %, Figure 3g). Subcutaneous hemorrhage was found in 67% of TMLox mice. Other sites of hemorrhage included the gastrointestinal tract (8%, Figure 3h) and the lung (10%, Figure 3i). Hematuria was occasionally (1%) observed in TMLox mice. Priapism (8% of male mice), consistent with occlusion of efferent venous blood vessels, was repeatedly observed and was in some cases associated with necrosis of a testis (Figure 3e). In one mouse displaying a sudden onset of severe gait ataxia, the cerebellum was replaced with a liquid-filled cyst.
Histological examination confirmed multiple venous and arterial thrombi in small-and large-caliber blood vessels. Fibrin-rich blood clots with few cellular components and organized, frequently recanalized cellular thrombi rich in collagen and fibrinogen were present at multiple sites (Figure 4, a and b). Extravascular fibrinogen deposition was increased in lungs of TMLox mice at the earliest time point analyzed (3 weeks). The increased fibrinogen deposition in the lung was associated with an increase of extracellular matrix and a disruption of the tissue architecture, resulting in distention of terminal airways and alveoli, destruction of alveolar septa and, in severe cases, formation of bullae (Figure 4c). The hearts of TMLox mice were significantly enlarged at ages 5 and 8 weeks (Figure 5a), with marked hypertrophy of the right ventricular wall (Figure 5c). These findings are consistent with increased resistance in the pulmonary vascular bed as a consequence of recurrent embolic and/or vascular lung injury and subsequent pulmonary hypertension. In addition, increased tissue fibrin levels (data not shown) and multiple foci of myocardial fibrosis (Figure 4d) were apparent in 8-week-old TMLox mice, indicating thrombosis of cardiac blood vessels. Of note, no thrombus formation was observed in cardiac atria, which has been described in factor V Leiden mice (26) and mice deficient in PC (27–29). Fibrin deposition, as determined by immunohistochemistry and Western blot analysis, was minimal in the brain of TMLox mice, whereas tissue fibrin levels in the lung and heart were increased (at age 3 and 8 weeks; data not shown).
Figure 4Histopathological analyses of TMLox mice. Histological analyses revealed multiple pathological findings in TMLox mice. (a) Intravascular thrombi in a peripheral vein (arrow) and the adjacent artery (arrowhead); hematoxylin and eosin (H&E) stain. (b) Intravascular thrombus in the liver, partially occluding a liver vein; H&E stain. (c and e) Trichrome stain of lung sections from TMLox (c) and TMwt (e) mice. Increased extracellular matrix content in the lung interstitium is associated with a marked destruction of the lung architecture and a loss of alveolar septa. (d and f) Trichrome stain of heart sections from TMLox (d) and TMwt (f) mice; multiple sites of myocardial fibrosis in the TMLox heart. Original magnification is indicated at lower right.
Figure 5Cardiomegaly in TMLox mice. Hearts of TMLox mice were enlarged compared with hearts from TMwt mice. (a) The weights of whole hearts from TMLox and TMwt mice at age 3, 5, and 8 weeks, corrected for the body weight. Hearts tended to be larger at age 3 weeks and were significantly enlarged at 5 and 8 weeks in TMLox mice. (b and c) H&E-stained histological sections obtained at comparative levels from hearts of TMwt (b) and TMLox (c) mice. The heart of the TMLox mice is overall enlarged with a striking hypertrophy of the right ventricular wall (arrowheads). Original magnification, ×20.
Coagulation activation in TMLox mice. Three-week-old TMLox mice without visible lesions demonstrated increased TAT and D-Dimer levels, and augmented consumption of fibrinogen and platelets compared with TMwt littermates (Table 2). In 5- to 8-week-old TMLox mice, TAT and D-Dimer levels remained high or increased even further, consistent with the progressive severity of thrombotic complications. Conversely, fibrinogen levels increased and platelet numbers normalized in older mice, indicating partial or complete compensation for consumption of fibrinogen and platelets. Consistent with compensatory platelet biosynthesis, the spleen weight (TMwt: 107.1 ± 26.7 mg; TMLox 283.0 ± 145.4 mg; P < 0.001) and number of megakaryocytes per splenocytes (TMwt: 38 ± 5.6/105 splenocytes; TMLox 118 ± 14.0/105 splenocytes; P = 0.02) were increased in 8-week-old, but not in 3-week-old, TMLox mice. Leukocyte numbers and hematocrit were identical between TMLox and TMwt mice at all ages. Evaluation of terminally diseased TMLox mice (n = 13) revealed a significantly prolonged whole-blood clotting time (TMwt: 6.5 ± 0.9 min, TMLox 37.4 ± 6.2 min; P < 0.001), and blood samples of six TMLox mice failed to form a blood clot within 60 minutes, suggesting consumptive coagulopathy as the disease end point. IL-1β and IL-6 levels were normal in 3-week-old TMLox mice compared with TMwt littermates, whereas in older TMLox mice with widespread organ damage IL-6 (but not IL-1β), values were elevated (data not shown).
Sex hormones modify the disease progression in TMLox mice. To evaluate the contribution of sex hormones to the differential disease onset and progression in male and female animals, TMLox and control mice were gonadectomized at age 18–19 days. Overall, the removal of gonads did not delay the manifestation of the phenotype or death (Figure 6a). Nevertheless, gonadectomy abolished the gender-specific differences in disease onset and mortality. On average, male TMLox mice succumbed at an older age to the consumptive coagulopathy than did female TMLox mice (Figure 6a, inset). This reversal of the disease course was not apparent in sham-operated TMLox animals.
Figure 6Effect of gonadectomy and anticoagulation on the disease progression and death in TMLox mice. (a) Gonadectomy before age 3 weeks did not prevent disease onset or death but reversed the sex-specific disease progression (inset). Gonadectomized TMLox mice, filled circles (n = 18); sham-operated TMLox mice, open diamonds (n = 14). Inset: gonadectomized males, filled squares (n = 10); gonadectomized females, open triangles (n = 8). (b and c) Warfarin treatment effectively prevents the overt thrombosis over an 8-week period (b, shaded area: warfarin treatment period), whereas typical lesions occur in mice from the placebo group (c, right; arrow: autoamputation of toes; arrowheads: hemorrhagic tail necrosis; double arrow: necrosis of the ear). The phenotype onset (“overt thrombosis”) does not included warfarin-induced hemorrhage. After termination of warfarin treatment at age 11 weeks, mice rapidly succumb to the prothrombotic challenge. The overall survival of warfarin-treated TMLox mice is not improved secondary to warfarin-induced hemorrhagic side effects (inset). Warfarin-treated TMLox mice, filled circles (n = 18); water-treated (placebo-treated) TMLox mice, open diamonds (n = 14). (d) During the warfarin treatment period, the body weight of TMLox mice normalizes, and after 8 weeks of anticoagulation, the weight difference between TMLox mice and TMwt littermates (age 11 weeks) loses significance. Yet mice again fail to thrive once treatment is terminated. TMLox mice, filled circles; TMwt mice, open diamonds (n = 12). Paired t-test; *P < 0.05. Shaded area: warfarin treatment period.
Anticoagulation with warfarin prevents disease onset in TMLox mice. Oral anticoagulation of TMLox mice with warfarin between ages 3 and 11 weeks completely prevented the onset of overt thrombosis. Warfarin-treated TMLox mice did not develop hemorrhagic or necrotic skin lesion (Figure 6, b and c), and the internal organs appeared normal upon autopsy except for minor liver lesions in some animals (two of four TMLox mice analyzed at the end of the treatment period). Total body weight (Figure 6d) and spleen weight (TMwt: 107.1 ± 26.7 mg; anticoagulated TMLox 125.0 ± 25.0 mg; P = 0.54) normalized during the treatment. Nevertheless, warfarin treatment failed to improve overall survival in TMLox mice secondary to lethal cerebral or intrathoracic hemorrhage (Figure 6b, inset). The fatal hemorrhages in anticoagulated animals were likely a direct consequence of bleeding complications associated with warfarin treatment, as (a) they occurred at an identical rate in warfarin-treated TMwt and TMLox mice, and (b) the tissue sites of hemorrhage were similar in warfarin-treated TMwt and TMLox mice, but distinct from the bleeding pattern observed in untreated TMLox mice with consumptive coagulopathy. Of note, initiation of warfarin therapy was not associated with appearance of purpuric skin lesions in TMLox or TMwt mice.
Copyright © 2024 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)