Elucidation of the thromboregulatory role of CD39/ectoapyrase in the ischemic brain
David J. Pinsky, M. Johan Broekman, Jacques J. Peschon, Kim L. Stocking, Tomoyuki Fujita, Ravichandran Ramasamy, E. Sander Connolly Jr., Judy Huang, Szilard Kiss, Yuan Zhang, Tanvir F. Choudhri, Ryan A. McTaggart, Hui Liao, Joan H.F. Drosopoulos, Virginia L. Price, Aaron J. Marcus, Charles R. Maliszewski
David J. Pinsky, M. Johan Broekman, Jacques J. Peschon, Kim L. Stocking, Tomoyuki Fujita, Ravichandran Ramasamy, E. Sander Connolly Jr., Judy Huang, Szilard Kiss, Yuan Zhang, Tanvir F. Choudhri, Ryan A. McTaggart, Hui Liao, Joan H.F. Drosopoulos, Virginia L. Price, Aaron J. Marcus, Charles R. Maliszewski
View: Text | PDF
Article Vascular biology

Elucidation of the thromboregulatory role of CD39/ectoapyrase in the ischemic brain

Abstract

Endothelial CD39 metabolizes ADP released from activated platelets. Recombinant soluble human CD39 (solCD39) potently inhibited ex vivo platelet aggregation in response to ADP and reduced cerebral infarct volumes in mice following transient middle cerebral artery occlusion, even when given 3 hours after stroke. Postischemic platelet and fibrin deposition were decreased and perfusion increased without increasing intracerebral hemorrhage. In contrast, aspirin did not increase postischemic blood flow or reduce infarction volume, but did increase intracerebral hemorrhage. Mice lacking the enzymatically active extracellular portion of the CD39 molecule were generated by replacement of exons 4–6 (apyrase-conserved regions 2–4) with a PGKneo cassette. Although CD39 mRNA 3′ of the neomycin cassette insertion site was detected, brains from these mice lacked both apyrase activity and CD39 immunoreactivity. Although their baseline phenotype, hematological profiles, and bleeding times were normal, cd39–/– mice exhibited increased cerebral infarct volumes and reduced postischemic perfusion. solCD39 reconstituted these mice, restoring postischemic cerebral perfusion and rescuing them from cerebral injury. These data demonstrate that CD39 exerts a protective thromboregulatory function in stroke.

Authors

David J. Pinsky, M. Johan Broekman, Jacques J. Peschon, Kim L. Stocking, Tomoyuki Fujita, Ravichandran Ramasamy, E. Sander Connolly Jr., Judy Huang, Szilard Kiss, Yuan Zhang, Tanvir F. Choudhri, Ryan A. McTaggart, Hui Liao, Joan H.F. Drosopoulos, Virginia L. Price, Aaron J. Marcus, Charles R. Maliszewski

×

Figure 5

Options: View larger image (or click on image) Download as PowerPoint
Generation of cd39–/– mice by homologous recombination. A gene targeting...
Generation of cd39–/– mice by homologous recombination. A gene targeting vector, in which a 4.1-kb SpeI-BglII fragment containing exons 4–6 (encoding apyrase-conserved regions 2–4) (22) was replaced with a PGKneo cassette (a), was introduced into 129-derived ES cells, and cells were selected in G418 and ganciclovir. Nine ES clones with a disrupted cd39 allele, identified by genomic Southern blot analyses of BglII-digested DNA (b), were injected into blastocysts and the resulting chimeras were crossed with C57BL/6 mice to produce cd39+/– heterozygotes. cd39–/– mice, generated at the expected Mendelian frequency from cd39+/– intercrosses, were overtly normal and did not display reproductive defects (not shown). The cd39–/– mice used represent random C57BL/6 × 129 hybrids. B, BglII; S, SpeI; A, Asp718. (c) Representative PCR analysis (25 cycles) of tail DNA, using primers within the region of the cd39 gene deleted by homologous recombination (primer 1, 5′GAACAGAGTTGGCTAAGCCTC3′; primer 2, 5′GAATGTCCTTGGCCAGTTTCTGCC3′), corresponding to a 236-bp fragment of exon 6. Each lane is from a different animal, with a genotype as indicated above the lanes. (d) Detection of expression of nonenzymatic encoding remnants of cd39 mRNA and mRNA from the neomycin cassette. The schema above the blots illustrates the regions against which probes A–D were constructed. Northern blots were performed on tissue mRNA extracts using these probes.