Advertisement
Estrogen’s bone-protective effects may involve differential IL-1 receptor regulation in human osteoclast-like cells
Teresa Sunyer,1 Jennifer Lewis,1 Patricia Collin-Osdoby,1,2 and Philip Osdoby1,2
1Department of Biology, and2Division of Bone and Mineral Research, Washington University, St. Louis, Missouri 63130, USA
Address correspondence to: Philip Osdoby, Department of Biology, Box 1229, Washington University, St. Louis, Missouri 63130, USA. Phone: (314) 935-4044; Fax: (314) 935-5134; E-mail: osdoby@biodec.wustl.edu.
Find articles by Sunyer, T. in: JCI | PubMed | Google Scholar
1Department of Biology, and2Division of Bone and Mineral Research, Washington University, St. Louis, Missouri 63130, USA
Address correspondence to: Philip Osdoby, Department of Biology, Box 1229, Washington University, St. Louis, Missouri 63130, USA. Phone: (314) 935-4044; Fax: (314) 935-5134; E-mail: osdoby@biodec.wustl.edu.
Find articles by Lewis, J. in: JCI | PubMed | Google Scholar
1Department of Biology, and2Division of Bone and Mineral Research, Washington University, St. Louis, Missouri 63130, USA
Address correspondence to: Philip Osdoby, Department of Biology, Box 1229, Washington University, St. Louis, Missouri 63130, USA. Phone: (314) 935-4044; Fax: (314) 935-5134; E-mail: osdoby@biodec.wustl.edu.
Find articles by Collin-Osdoby, P. in: JCI | PubMed | Google Scholar
1Department of Biology, and2Division of Bone and Mineral Research, Washington University, St. Louis, Missouri 63130, USA
Address correspondence to: Philip Osdoby, Department of Biology, Box 1229, Washington University, St. Louis, Missouri 63130, USA. Phone: (314) 935-4044; Fax: (314) 935-5134; E-mail: osdoby@biodec.wustl.edu.
Find articles by Osdoby, P. in: JCI | PubMed | Google Scholar
Published May 15, 1999 - More info
J Clin Invest. 1999;103(10):1409–1418. https://doi.org/10.1172/JCI4682.
© 1999 The American Society for Clinical Investigation
Received: July 23, 1998; Accepted: April 16, 1999
-
Methods
Materials. Recombinant human IL-1β (R&D Systems Inc., Minneapolis, Minnesota, USA) was reconstituted in PBS with 1% BSA and stored as aliquots at –70°C. Dexamethasone, 17β-estradiol, and 17α-estradiol (all from Sigma Chemical Co., St. Louis, Missouri, USA) were freshly prepared in ethanol at a concentration of 10–3 M and further diluted in culture medium for use. Vehicle (ethanol) controls were similarly diluted. 1,25[OH]2 vitamin D3, a gift from Hoffman-La Roche (Nutley, New Jersey, USA), was stored dry at –70°C and reconstituted in ethanol before use. Neutralizing antibodies for the IL-1 receptors, anti-human IL-1RII antigen affinity-purified IgG (catalog no. AF-263-NA; R&D Systems Inc.) and anti-human IL-1RI total IgG (catalog no. AB-269-NA; R&D Systems Inc.), were reconstituted in PBS at 0.1 mg/mL and 1 mg/mL, respectively. FBS and α-MEM were from GIBCO BRL (Gaithersburg, Maryland, USA).
Isolation of OCs from human bones. Human OCs (hOCs) were isolated from femoral heads obtained as discarded surgical material from osteoporotic patients undergoing hip replacement or from segments of bone removed from sites of implant loosening during resection, using a modification of the methods to isolate and purify avian OCs (46) as described recently (45, 47). Briefly, cells were released from small pieces of bone by trypsin and collagenase digestion, and cell cultures were enriched for hOCs by Percoll fractionation. Cells were cultured in phenol red–free medium 199 Earle’s salts supplemented with 8.3 mM NaHCO3, 100 mM HEPES (pH 6.8), 5% FBS, and 2.5% antibiotic/antimycotic for 16–24 hours before harvest for RNA extraction. Highly purified hOC preparations were obtained by immunomagnetic purification with the specific anti-OC mAb 121F (46) and immediately harvested for RNA extraction. Purified hOC cultures consisted of approximately 90% multinucleated OCs that exhibited all typical osteoclastic attributes, including calcitonin responsiveness and the ability to form resorption pits when cultured on bone or ivory slices.
Isolation and culture of human bone marrow–derived cells and osteoblasts. Bone marrow was obtained from human rib segments discarded during thoracic surgery or from donated iliac crest bone or rib segment derived from individuals with no identified bone pathologies. Marrow mononuclear cells separated by Ficoll-Hypaque density gradients (Pharmacia Biotech Inc., Piscataway, New Jersey, USA) were induced to form multinucleated human OC–like (hOCL) cells by treatment with 10 nM 1,25[OH]2 vitamin D3 and osteoblast-conditioned medium as described previously (43, 48). Cell preparations were highly enriched for hOCL cells, which were calcitonin receptor positive, by brief trypsinization to remove contaminating stromal cells selectively (43). The remaining purified hOCLs were subsequently detached from the culture dish by further trypsin treatment combined with gentle scraping, and the hOCL cells were replated in phenol red–free α-MEM containing 10% FBS and 1% antibiotic/antimycotic at 0.3–0.7 × 106 cells per well of a 6-well culture dish. Human stromal cells were obtained from the same bone marrow mononuclear preparations used for the generation of hOCL cells and were induced to become mineralizing human osteoblast–like (hOBL) cells by treatment with dexamethasone for 6 days according to Cheng et al. (49). Cultures of in vivo–formed human osteoblasts (hOBs) were prepared as trabecular outgrowth cells from surgical specimens of rib bone (50). All cell cultures were given phenol red–free and dexamethasone-free α-MEM containing 10% FBS and 1% antibiotic/antimycotic at least 24 hours before the addition of fresh medium containing modulators or matched vehicle controls. After the indicated incubation times, conditioned medium was collected, briefly centrifuged, and stored at –20°C until analyzed, and the cells were harvested for RNA extraction.
RNA isolation and analysis. Total RNA was obtained from cells using RNA STAT-60 (Tel-Test Inc., Friendswood, Texas, USA) and was analyzed by the following methods. RT-PCR: cDNA was prepared from 5 μg of total RNA using random hexamer primers (cDNA cycle kit; Invitrogen, San Diego, California, USA), and 10–20% of the cDNA was used for each PCR amplification (30 cycles). Specific primers for PCR were the following: IL-1RI forward, GGTGACAGTAACTGGTGTT; IL-1RI reverse, ACGTTGGGGAAGACATTGTT (from GenBank locus HUMILRA); IL-1RII forward, CAACATCACTAGGAGTATTGA; IL-1RII reverse, CAATGCCCCAGGAGA ACGTGGA (from locus HSIL1R2II); GAPDH forward, ATTCCACCCATGGCAAATTC; and GAPDH reverse, GGCAGAGATGATGACCCT (from locus HUMGAPDHG). RT-PCR products were subcloned into the pCRII vector (TA cloning kit; Invitrogen) and sequenced (Sequenase kit; USB, Cleveland, Ohio, USA). RT-PCR amplifications of the estrogen receptor followed the protocol of Arts et al. (51) using the following primers: ER-α forward, AATTCAGATAATCGACGCCAG; ER-α reverse, GTGTTTCAACATTCTCCCTCCTC (from GenBank locus HUMERMCF) at a concentration of 5 nM for the first round of amplification (30 cycles); ER-α forward nested, GACAAGGGAAGTATGGCTATGGA; and the same ER-α reverse at 1 μM in the second round (30 cycles). The ER PCR amplicons were directly sequenced using an ABI Prism Cycle Sequencing kit (Perkin-Elmer, Foster City, California, USA).
Northern blot analysis. Northern analysis was performed with poly(A)-selected RNA (Oligotex kit; QIAGEN Inc., Chatsworth, California, USA) obtained from 100 μg of total RNA. RNA blots were sequentially hybridized with radioactively labeled probes (Random Primers DNA Labeling System; GIBCO BRL) for 18 hours at 42°C. After extensive washing, hybridized blots were subjected to autoradiographic detection. Blots were stripped between probes when necessary.
Ribonuclease protection assays. RNA probes for ribonuclease protection assays (RPAs) were generated from the IL-1RI and IL-1RII PCR clones already described here or from a 406-bp human IL-8 cDNA (kindly provided by S. Kunkel, Department of Pathology, University of Michigan Medical School, Ann Arbor, Michigan, USA), using the in vitro transcription kit MAXIscript (Ambion Inc., Austin, Texas, USA), and were purified in 5% polyacrylamide/8 M urea gels. RPA was performed using the RPAII kit (Ambion Inc.) by hybridizing 5–10 μg of total RNA for 18 hours at 45°C with 100,000 cpm IL-1RI (511 bp), 100,000 cpm IL-1RII (425 bp), or 20,000 cpm IL-8 (492 bp) probes, together with 20,000 cpm GAPDH (259 bp). The protected fragments (368 bp IL-1RI, 279 bp IL-1RII, 406 bp IL-8, and 170 bp GAPDH) were separated in 8% polyacrylamide/8 M urea gels, detected by autoradiography, and quantified in a scanner (ScanJet II; Hewlett-Packard, Palo Alto, California, USA) linked to Quantimet 500 image analysis software (Leica, Cambridge, United Kingdom), or directly quantified in a PhosphorImager (Molecular Dynamics, Sunnyvale, California, USA), yielding comparable results.
Quantification of IL-8 and sIL-1RII release. IL-8 or sIL-1RII levels in the conditioned media of hOCL and hOBL cell cultures were measured by ELISA using Quantikine kits (R&D Systems Inc.) following the manufacturer’s specifications. IL-8 and sIL-1RII release was normalized to cellular protein in the culture dish based on the bicinchoninic acid (BCA) assay (Pierce Chemical Co., Rockford, Illinois, USA). Alternatively, sIL-1RII release into the conditioned medium was expressed in relation to the total RNA obtained from the culture dish.
Apoptosis assay. Highly enriched hOCL cells were cultured on glass coverslips in phenol red–free α-MEM containing 10% charcoal-stripped FBS and 1% antibiotic/antimycotic, and treated with the various modulators (see the legend for Figure 7) for a total of 22 hours. Attached cells were then washed 3 times with warm HBSS and stained for 12 minutes in the dark using annexin V-fluorescein (to stain apoptotic and necrotic cell membranes) combined with propidium iodide (to stain only necrotic cell nuclei) as provided in a kit (Boehringer Mannheim Biochemicals, Indianapolis, Indiana, USA). Coverslips were mounted with buffered glycerol mounting medium (BBL 40825, Becton Dickinson, Cockeysville, Maryland, USA) supplemented with 5 mM CaCl2, and labeled cells were viewed and counted by fluorescence microscopy. Annexin-stained cells from 3–5 independent cell cultures derived from 2 different bone marrow donors were evaluated across 10–16 fields, encompassing a total of 2,400–3,700 hOCL for each control or experimental condition.
Figure 717β-estradiol pretreatment of hOCL cells inhibits IL-1–promoted cell survival. hOCL cells cultured on glass coverslips were preincubated for 4 hours with 10–7 M 17β-estradiol (E2, +) or vehicle (–). After pretreatment, the same modulators were added to the cell cultures simultaneously with 10–9 M IL-1β (IL-1, +) or vehicle (–), and the cells were further incubated for another 18 hours. hOCL cells were then stained with annexin V-fluorescein to identify apoptotic cells, and a total of 2,400–3,700 hOCL cells for each experimental condition were viewed in 10–16 fields and counted by fluorescence microscopy. Data are expressed as the mean ± SEM percentage of annexin V–labeled apoptotic hOCL cells relative to total hOCL cells per field for each condition. No necrotic cells (stained with propidium iodide) were detected in these cultures. Significant differences from control cultures: **P < 0.001. Significant differences from IL-1–treated cultures: +P < 0.05.
Statistical analysis. Data are presented as the mean ± SEM of at least 3 independent replicate cell cultures. Differences between treatments were analyzed using single-factor ANOVA. For simultaneous comparisons between multiple treatments, significant differences were determined using the post-ANOVA Bonferroni test. Differences were considered significant for P < 0.05.
-
Results
hOC and hOCL cells express mRNA for both IL-1RI and IL-1RII. IL-1 receptor mRNA expression in hOC and hOCL cells was analyzed by RT-PCR using specific oligonucleotides designed to recognize unique regions of the human IL-1RI and IL-1RII genes (Figure 1a). In vivo–formed bone-resorptive hOCs directly isolated from human bones, as well as multinucleated hOCL cells differentiated in vitro from human bone marrow–derived mononuclear cells, expressed mRNA for both the signaling IL-1RI and the decoy IL-1RII. In contrast, bone marrow–derived stromal cells (not shown) and stromal-derived hOBL cells, cell types that are unrelated to the hematopoietic lineage, expressed mRNA for the signaling IL-1RI but undetectable levels of the decoy IL-1RII (Figure 1b). Because hOCL cells exhibit multiple OC phenotypic characteristics and, like hOC, expressed mRNA for both the signaling and decoy IL-1Rs, further studies to investigate potential regulation of these IL-1Rs were performed using hOCL cells, which are more readily available in larger numbers and are easier to purify from contaminating cells than hOCs.
Figure 1hOC and hOCL cells express mRNA for both the type I and type II IL-1 receptors. (a) Schematic representation of the human IL-1 receptor genes. Hatched bars represent the extracellular regions of the proteins; filled bars represent the transmembrane domains; and open bars represent the intracellular tails. Arrowheads indicate the location of primers used in RT-PCR. (b) RT-PCR of IL-1RI (I) and IL-1RII (II) from hOCs directly isolated from a femoral head of a 76-year-old woman undergoing hip replacement surgery, and from hOCL and hOBL cells generated from a single bone marrow mononuclear preparation derived from a 58-year-old woman. Amplicons were separated in 1.5% agarose gels and viewed with ethidium bromide. Similar results were obtained by RT-PCR analysis for IL-1RI and IL-1RII in hOCs directly isolated from osteopenic bone specimens obtained from 6 patients (4 women of 71, 76, 78, and 78 years of age; and 2 men of 56 and 78 years of age) undergoing hip replacement surgery, and a patient with implant osteolysis (a 71-year-old man). St., molecular weight standards.
hOCL cells express functional IL-1RI and release sIL-1RII to the media. Previously, we showed that hOCL cells responded dose dependently to IL-1 with increases in IL-8 mRNA and protein production. Here we determined that this hOCL cell response to IL-1 was mediated by the signaling IL-1RI because the IL-1β–induced accumulation of IL-8 in the conditioned medium of hOCL cell cultures was inhibited by an IL-1RI neutralizing antibody, but not by similar doses of a neutralizing antibody to the decoy IL-1RII (Figure 2). Thus, hOCL cells contain functional signaling IL-1RI in their plasma membrane. In addition, hOCL cells also expressed IL-1RII protein based on immunodetection of sIL-1RII in the conditioned media of the same cell cultures (8 ng sIL-1RII/mg of cellular protein). These results indicate that hOCL cells not only express both IL-1R mRNAs, but also synthesize IL-1RI and IL-1RII proteins and functionally respond to IL-1.
Figure 2IL-1 induction of IL-8 in hOCL cells is mediated by the signaling IL-1RI. Bone marrow–derived hOCL cells were preincubated for 1 hour in the absence (0) or presence of neutralizing antibodies to the signaling IL-1RI (5 or 50 μg/mL) or the decoy IL-1RII (1 or 5 μg/mL) at concentrations that represent approximately 1–10 times their ND50 (antibody concentration required for half-maximal inhibition of IL-1 activity as determined by the manufacturer). Cell cultures were then treated for 16 hours with 10–9 M IL-1β (+) or vehicle (–), and the cells were harvested for protein determination. IL-8 cytokine release was measured in the conditioned medium, normalized by the total cellular protein in each culture dish, and expressed as the mean ± SEM of nanograms of IL-8 released per milligrams of cell protein. Significant differences from control cultures: **P < 0.01. Significant differences from IL-1–treated cultures: +P < 0.05. Determined by Bonferroni post-ANOVA test for multiple comparisons.
Relative steady-state mRNA levels for IL-1RI and IL-1RII in hOCL cells vary among bone marrow donors. Evaluation of the mRNA levels for each IL-1R subtype in hOCL cell cultures derived from 28 independent bone marrow donors by Northern or RPA analysis, using IL-1R probes generated from RT-PCR amplicons, revealed substantial differences in the relative expression levels of the 2 IL-1R transcripts. Thus, whereas these probes identified mRNA of the expected size in Northern analyses of 2 independent hOCL cell cultures, the relative steady-state levels of the 2 IL-1R transcripts were quite different (Figure 3a). A similar variation in the relative levels of these IL-1R mRNA species was also detected by RPA for hOCL cell cultures obtained from other independent bone marrow donors (Figure 3b). By contrast, hOBL cell cultures generated from some of these same bone marrow mononuclear preparations consistently expressed relatively high levels of IL-1RI mRNA and undetectable levels of IL-1RII mRNA, as analyzed either by RPA (Figure 3b) or by RT-PCR (Figure 1). The steady-state levels of IL-1RII mRNA in the various cell preparations correlated well with the amount of sIL-RII measured in their conditioned medium. Therefore, whereas independent hOCL cell cultures exhibited variable levels of sIL-RII that ranged from 7 to 400 pg sIL-1RII accumulated in the conditioned medium after 4–8 hours of culture per microgram of total RNA (mean: 92.6 ± 35.8 [SEM]; n = 12; median: 48.35; 95% confidence interval [CI]: 13.7, 171.5), sIL-1RII was undetectable in the conditioned media of bone marrow–derived hOBL cells or hOB isolated from bone segments that were cultured for similar times.
Figure 3Steady-state mRNA levels for IL-1RI and IL-1RII vary among hOCL cells generated from different donors. (a) Northern analysis of poly(A)-selected RNA from hOCL cells derived from 2 different individuals (designated 1 and 2) sequentially hybridized with the indicated probes. Transcripts were identified of the following approximate sizes: 5.6-kb IL-1RI, 1.4-kb IL-1RII, 1.4-kb GAPDH, and 2.0-kb β-actin. Amounts of each radioactive probe used and times of gel exposure for autoradiography were as follows: IL-1RI, 3 × 106 cpm/mL, 7 days; IL-1RII, 3 × 106 cpm/mL, 14 days; GAPDH, 2 × 106 cpm/mL, 20 hours; and β-actin, 1 × 106 cpm/mL, 60 hours. (b) Representative RPA for IL-1RI and IL-1RII using total RNA from hOCL and hOBL cells that were obtained from the same bone marrow mononuclear cultures of 2 different individuals (designated 3 and 4). Each sample was probed simultaneously with IL-1RI (I) and GAPDH, or in a parallel reaction with IL-1RII (II) and GAPDH. To attribute correctly the protected bands as signals for IL-1RI, IL-1RII, and GAPDH, reactions were first performed with each individual probe alone. Specific protected bands were of the expected sizes, which differed from one another, and were clearly discernible from full-length unprotected probes (which were included along with molecular size markers in the gels). The data shown in b were obtained from a single RPA and set of labeled probes. Additional RPAs performed with hOCL cells derived from 25 other donors yielded similar variations in their relative steady-state mRNA levels of the 2 IL-1Rs, a feature inherent to the hOCL cell preparations themselves (see Figure 4).
IL-1RII/IL-1RI mRNA ratios in hOCL cells correlate with the age and gender of the bone marrow donor. RPA analysis of IL-1R mRNA relative levels was performed in hOCL cells derived from bone marrow mononuclear preparations of 22 different donors over the age of 40, and the results were expressed as the ratio IL-1RII/IL-1RI mRNA (Table 1). Analysis of the data revealed that, even for the limited number of cases available to test (n = 11), there was a statistically significant (P = 0.002) inverse linear correlation (r = –0.81) between the levels of the decoy IL-1RII mRNA relative to those of the signaling IL-1RI and increasing age of the female donor (Figure 4a). Therefore, hOCL cells from older women in the postmenopausal period (over 60 years old) had equivalent or lower mRNA levels for the decoy IL-1RII compared with the signaling IL-1RI, whereas hOCL cells from younger women in the perimenopausal or early postmenopausal periods had significantly higher mRNA steady-state levels for the decoy IL-1RII compared with the signaling IL-1RI. Similar to mRNA levels, sIL-1RII protein levels measured in the conditioned medium of hOCL cells derived from female bone marrow donors (n = 5) were also inversely correlated (r = –0.86) with the age of the female donors, although this did not quite reach significance (P = 0.06) in this small sample group. These findings suggested that the declining levels of estrogen in postmenopausal women might influence the steady-state levels of IL-1R mRNAs and sIL-1RII released from cultured bone marrow–derived hOCL cells obtained from female donors. This inverse correlation between relative IL-1R mRNA levels and age was not observed among the same number (n = 11) of hOCL cell cultures obtained from male donors of approximately the same age range. To the contrary, no correlation (r = 0.15, P = 0.66) was obtained between IL-1R mRNA ratios and age of the male donor (Figure 4b).
Figure 4IL-1RII/IL-1RI steady-state mRNA ratios in hOCL cells decrease with increasing age of female, but not male, bone marrow donors. Steady-state mRNA levels for IL-1RI, IL-1RII, and the internal control GAPDH were measured in hOCL cells generated from 11 women ranging from 51 to 72 years of age (a), and from 11 men ranging from 40 to 68 years of age (b), as described in Figure 3b. No bone marrow samples were available from female donors of 40 to 50 years of age. The IL-1RII/IL-1RI mRNA ratios were calculated as follows: the signal intensity of each IL-1R protected band was divided by the signal intensity of the corresponding internal GAPDH control for that reaction, and the normalized value for IL-1RII was then divided by the normalized value for IL-1RI (Table 1). P, statistical significance as determined by ANOVA; r, correlation coefficient. Typically, as many RNA samples as possible were run in a single RPA (using the same gel and probes) to enable direct comparisons. In addition, RNA obtained from 2 different hOCL cell cultures each was reanalyzed in 3 separate RPA trials to calculate the variances associated with determining the IL-1RII/IL-1RI mRNA ratios across independent RPA experiments. Thus, independent assessments of the IL-1RII/IL-1RI ratio for hOCL cells derived from a 72-year-old woman yielded values of 0.28, 0.3, and 0.32 with a variance of 0.0004, and hOCL cells from a 51-year-old woman yielded ratios of 2.4, 1.8, and 2.0 with a variance of 0.093.
Table 1Comparison of the steady-state IL-1RII/IL-1RI mRNA ratios (II/I) in bone marrow–derived hOCL cells relative to the age and gender of the donor
Estrogen decreases signaling IL-1RI while increasing decoy IL-1RII mRNA levels in cultured hOCL cells. Most bone marrow was obtained from accident victims; therefore, information on the donor estrogen status was not available for direct comparison with IL-1R mRNA ratios in the generated hOCL cells. The hypothesis that estrogen might differentially influence IL-1R mRNA levels in hOCL cells was directly investigated in vitro. First, RT-PCR analysis was performed to demonstrate that the marrow-derived hOCL cells used in this study, as well as authentic hOCs directly isolated from human bones, expressed mRNA for ER-α (Figure 5a). We then tested whether 17β-estradiol could regulate the steady-state mRNA levels for IL-1RI and IL-1RII measured by RPA in hOCL cells cultured with or without 17β-estradiol for 4 hours. 17β-estradiol dose dependently inhibited the steady-state mRNA levels of the signaling IL-1RI while stimulating those of the decoy IL-1RII (Figure 5, b–d). Thus, treatment with 10–7 M 17β-estradiol, but not with the same concentration of the inactive analogue 17α-estradiol, caused a statistically significant reduction of ∼30 ± 7% in the steady-state levels of IL-1RI mRNA, together with a significant increase to ∼200 ± 40% of control levels in the steady-state expression of IL-1RII mRNA. Similar responses occurred in hOCL cells generated from the bone marrow of either female or male donors. Furthermore, treatment of hOCL cells (n = 6 from 4 independent bone marrow donors) for 8 hours with 10–7 M 17β-estradiol caused a significant increase (50%, P = 0.045) in the levels of sIL-1RII released into the conditioned medium (mean ratio of estrogen-treated to control cultures was 1.504 ± 0.213 [SEM]; median: 1.42; 95% CI: 0.987, 2.317; variance: 0.274). In contrast to hOCL cells, 17β-estradiol did not modify either the steady-state levels of IL-1RI or IL-1RII mRNA in 3 independent stromal-derived hOBL cell or hOB cultures.
Figure 517β-estradiol differentially regulates IL-1RI and IL-1RII mRNA levels in hOCL. (a) hOC and hOCL cells express mRNA for ER-α. RT-PCR analysis of ER-α and GAPDH was performed using total RNA of immunomagnetically purified hOC directly isolated from a femoral head or from purified bone marrow–derived hOCL cells. Amplicons were separated in 1.5% agarose gels and stained with ethidium bromide. (b–e) 17β-estradiol decreased signaling IL-1RI and increased decoy IL-1RII mRNA levels in hOCL cells. hOCL cell cultures derived from 5 different bone marrow donors (2 women and 3 men, 1 to 3 replicate wells each) were incubated for 4 hours with vehicle (0), 10 or 100 nM 17β-estradiol (E2), or 100 nM of the inactive analogue 17α-estradiol. Total RNA was extracted, and steady-state mRNA levels for IL-1RI, IL-1RII, and GAPDH were measured by RPA. (b and c) Representative RPA for IL-1RI and GAPDH mRNA (b), and for IL-1RII and GAPDH mRNA (c). (d and e) Protected IL-1R mRNA bands were quantified and normalized to GAPDH. The data are expressed as a percentage of vehicle control and represent the mean ± SEM of the IL-1RI/GAPDH ratio (d) or the IL-1RII/GAPDH ratio (e). Significant differences from control cultures: *P < 0.05 as determined by Bonferroni post-ANOVA test for multiple comparisons. St., molecular weight standards.
Estrogen pretreatment suppresses the IL-1 responsiveness of hOCL, but not hOBL, cells. To test whether estrogen-induced alterations in the IL-1R mRNA levels of hOCL cells had physiological consequences relative to their ability to respond to IL-1, hOCL cell cultures were preincubated for 4 hours with 17β-estradiol (10–7 M) or vehicle before being challenged with IL-1β (10–9 M, 4 hours), and the levels of IL-8 mRNA were assessed as a sensitive reflection of IL-1 responsiveness. 17β-estradiol alone did not alter the basal steady-state levels of IL-8 mRNA in hOCL cells, whereas incubation with IL-1 resulted in a typical ∼3-fold increase in IL-8 mRNA levels. However, pretreatment with 17β-estradiol diminished the IL-1 responsiveness of hOCL cells by ∼60% (± 2.7 SEM), as reflected in IL-8 mRNA induction (Figure 6a). Furthermore, we noted that the magnitude of the estrogen inhibitory effect was inversely correlated with the levels of decoy IL-1RII in 3 bone marrow preparations from which sufficient numbers of hOCL cells were generated to permit multiple analyses. Thus, IL-1RII/IL-1RI mRNA ratios (3.1, 1.5, and 0.2, respectively) and sIL-1RII release (400, 41, and 6 pg/μg RNA, respectively) in these 3 hOCL cell preparations were inversely correlated with IL-1 responsiveness (1.87-, 2.02-, and 4.9-fold IL-8 mRNA induction, respectively), estrogen stimulation of sIL-1RII release (1.05-, 1.2-, and 1.85-fold increase, respectively), and estrogen inhibition of IL-1–induced IL-8 mRNA (31%, 44%, and 53% inhibition, respectively). Parallel studies showed that stromal-derived hOBL cells and primary hOBs, both of which were shown to express only signaling IL-1RI mRNA, also responded to IL-1 treatment with an induction of IL-8 mRNA of ∼4.5-fold over control, but they were insensitive to the inhibitory action of 17β-estradiol pretreatment on IL-8 mRNA levels (Figure 6d). Further studies to document the estrogen inhibition of hOCL cell IL-1 responsiveness were performed based on annexin V-fluorescein labeling of apoptotic cells. hOCL cell cultures were pretreated with vehicle or 17β-estradiol (10–7 M, 4 hours) before being challenged with IL-1β (10–9 M, 18 hours) and stained for annexin V binding. The proportion (5.2% ± 0.67 [SEM]) of apoptotic hOCL cells present in control cultures was not significantly affected by 17β-estradiol alone, but it was significantly decreased (∼60%) by IL-1 treatment. However, 17β-estradiol pretreatment of hOCL cells before IL-1 exposure fully inhibited (P < 0.05) the cell survival effects of IL-1 (Figure 7). This effect was not observed using the inactive analogue 17α-estradiol (not shown). Thus, estrogen-induced modulation of IL-1RI and IL-1RII mRNA levels is associated with inhibitions in 2 independent functional measures of IL-1 biologic responsiveness in hOCL cells.
Figure 617β-estradiol pretreatment of hOCL cells, but not hOBL cells, inhibits IL-1 induction of IL-8 mRNA. hOCL cells (a and b) or hOBL cells (c and d) were preincubated for 4 hours with 10–7 M 17β-estradiol (E2, +) or vehicle (–). After pretreatment, the same modulators were added to the cell cultures simultaneously with 10–9 M IL-1β (IL-1, +) or vehicle (–), and the cells were further incubated for another 4 hours. Total RNA was extracted, and IL-8 mRNA was analyzed by RPA as a functional measure of IL-1 biologic responsiveness. (a and c) Representative RPA for IL-8 mRNA levels in hOCL and hOBL, respectively. (b and d) IL-8 mRNA protected bands from 3 independent hOCL (b) or hOBL (d) cell cultures were quantified and normalized to GAPDH. Additional results obtained using a primary hOB cell culture were indistinguishable from those obtained with the hOBL cell cultures. Data are expressed as a percentage of maximal IL-8 mRNA levels induced by IL-1β and represent the mean ± SEM. Significant differences from control cultures: **P < 0.01, ***P < 0.001. Significant differences from IL-1β–treated cultures: ++P < 0.01 as determined by the Bonferroni post-ANOVA test.
Copyright © 2024 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)