Go to JCI Insight
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
  • Clinical Research and Public Health
  • Current issue
  • Past issues
  • By specialty
    • COVID-19
    • Cardiology
    • Gastroenterology
    • Immunology
    • Metabolism
    • Nephrology
    • Neuroscience
    • Oncology
    • Pulmonology
    • Vascular biology
    • All ...
  • Videos
    • Conversations with Giants in Medicine
    • Video Abstracts
  • Reviews
    • View all reviews ...
    • Complement Biology and Therapeutics (May 2025)
    • Evolving insights into MASLD and MASH pathogenesis and treatment (Apr 2025)
    • Microbiome in Health and Disease (Feb 2025)
    • Substance Use Disorders (Oct 2024)
    • Clonal Hematopoiesis (Oct 2024)
    • Sex Differences in Medicine (Sep 2024)
    • Vascular Malformations (Apr 2024)
    • View all review series ...
  • Viewpoint
  • Collections
    • In-Press Preview
    • Clinical Research and Public Health
    • Research Letters
    • Letters to the Editor
    • Editorials
    • Commentaries
    • Editor's notes
    • Reviews
    • Viewpoints
    • 100th anniversary
    • Top read articles

  • Current issue
  • Past issues
  • Specialties
  • Reviews
  • Review series
  • Conversations with Giants in Medicine
  • Video Abstracts
  • In-Press Preview
  • Clinical Research and Public Health
  • Research Letters
  • Letters to the Editor
  • Editorials
  • Commentaries
  • Editor's notes
  • Reviews
  • Viewpoints
  • 100th anniversary
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity
Jeremy R. Graff, … , Julia H. Carter, Eric G. Marcusson
Jeremy R. Graff, … , Julia H. Carter, Eric G. Marcusson
Published September 4, 2007
Citation Information: J Clin Invest. 2007;117(9):2638-2648. https://doi.org/10.1172/JCI32044.
View: Text | PDF
Research Article Article has an altmetric score of 15

Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity

  • Text
  • PDF
Abstract

Expression of eukaryotic translation initiation factor 4E (eIF4E) is commonly elevated in human and experimental cancers, promoting angiogenesis and tumor growth. Elevated eIF4E levels selectively increase translation of growth factors important in malignancy (e.g., VEGF, cyclin D1) and is thereby an attractive anticancer therapeutic target. Yet to date, no eIF4E-specific therapy has been developed. Herein we report development of eIF4E-specific antisense oligonucleotides (ASOs) designed to have the necessary tissue stability and nuclease resistance required for systemic anticancer therapy. In mammalian cultured cells, these ASOs specifically targeted the eIF4E mRNA for destruction, repressing expression of eIF4E-regulated proteins (e.g., VEGF, cyclin D1, survivin, c-myc, Bcl-2), inducing apoptosis, and preventing endothelial cells from forming vessel-like structures. Most importantly, intravenous ASO administration selectively and significantly reduced eIF4E expression in human tumor xenografts, significantly suppressing tumor growth. Because these ASOs also target murine eIF4E, we assessed the impact of eIF4E reduction in normal tissues. Despite reducing eIF4E levels by 80% in mouse liver, eIF4E-specific ASO administration did not affect body weight, organ weight, or liver transaminase levels, thereby providing the first in vivo evidence that cancers may be more susceptible to eIF4E inhibition than normal tissues. These data have prompted eIF4E-specific ASO clinical trials for the treatment of human cancers.

Authors

Jeremy R. Graff, Bruce W. Konicek, Thomas M. Vincent, Rebecca L. Lynch, David Monteith, Spring N. Weir, Phil Schwier, Andrew Capen, Robin L. Goode, Michele S. Dowless, Yuefeng Chen, Hong Zhang, Sean Sissons, Karen Cox, Ann M. McNulty, Stephen H. Parsons, Tao Wang, Lillian Sams, Sandaruwan Geeganage, Larry E. Douglass, Blake Lee Neubauer, Nicholas M. Dean, Kerry Blanchard, Jianyong Shou, Louis F. Stancato, Julia H. Carter, Eric G. Marcusson

×

Figure 2

eIF4E expression is reduced in cultured human and murine cells.

Options: View larger image (or click on image) Download as PowerPoint
eIF4E expression is reduced in cultured human and murine cells.
(A) eIF4...
(A) eIF4E expression was assessed by quantitative RT-PCR. Representative data are shown for human cervical carcinoma cells (HeLa), human non–small cell lung cancer cells (A549), and murine endothelial cells (b.END cells) 24 hours after transfection. Cells were transfected using lipofectin, the eIF4E-specific ASOs, or the non-silencing ASO controls at the indicated concentrations (5′–3′, ASO ctrlA, GGATAGAACGCGAAAGCTTG; ASO ctrlB, GTACAGTTATGCGCGGTAGA; ASO ctrlC, CGTTATTAACCTCCGTTGAA; ASO ctrlD, TTAGAATACGTCGCGTTATG). Data are presented as the percentage of eIF4E in control untransfected cells. (B–D) eIF4E protein expression was evaluated by Western blotting from cell lysates harvested 72 hours after transfection. Each blot was reprobed for β-actin to control for loading and transfer variations. Representative data are shown for human prostate cancer cell lines (CWR22Rv1 and PC-3), head and neck cancer cell lines (FaDu and SW579), a human breast cancer cell line (MDA-MB-231), a human non–small cell lung cancer cell line (NCI-H460), and the HUVEC. (B) Cells were transfected with 50, 100, or 200 nM 4E-ASO4 or the ASO control. (C) Data shown represent cells transfected with 200 nM 4E-ASO4 or the mismatch (MM) control. (D and E) MDA-MB-231 breast cancer cells were transfected with 4E-ASO4 or mismatch control ASO. Protein was harvested 72 hours after transfection, and lysates were analyzed by Western blotting for the indicated proteins.

Copyright © 2025 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)

Sign up for email alerts

Referenced in 14 patents
Referenced in 1 Wikipedia pages
156 readers on Mendeley
See more details